The protein-encoding gene translation elongation factor 1-α (TEF1-α) was amplified for most samples, following protocols of Rehner and Buckley [35] for Cordycipitaceae (primer pair 983F and ...

2014年12月30日 · Intra- and interspecies variations of the translation elongation factor 1-α ( Tef-1α) gene were evaluated as a new identification marker in a wide range of dermatophytes, which included 167 strains of 30 species. An optimized pan-dermatophyte primer pair was designed, and the target was sequenced.

The present study involved the design of a specific pan-Candida primer set in the TEF-1α gene where the primer sequences are conserved within Candida species but distinct from a variety of fungi other than Candida species and the bacterium Escherichia coli.

In the present study, we evaluated two Fusarium -specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species.

2017年2月15日 · The study concluded that a novel, high-fidelity primer pair (EF1–1018F GAYTTCATCAAGAACATGAT and EF1–1620R GACGTTGAADCCRACRTTGTC) for tef-1, which is already widely used as a phylogenetic marker in mycology, has the best potential to serve as a secondary DNA barcode, offering superior resolution to ITS (for protocol, see Table S1).

In addition, a phylogenetic tree using translation elongation factor subunit 1-alpha (tef-1α) from isolates across the globe are used to present a global phylogenetic framework for the genus.

The ITS-Fuf-r primer (Abd-Elsalam et al., 2003) was used for Fusarium spp., and TEF1-α gene primers (Arif et al., 2012; TEF-Fs4f: ATCGGCCACGTCGACTCT and TEF-Fs4r: GGCGTCTGTTGATTGTTAGC) were...

Three primer sets to amplify TEF-1α, namely MpTefF/MpTefR, MsTefF/MsTefR, and MeTefF/MeTefR, were designed for M. phaseolina, M. pseudophaseolina, and M. euphorbiicola, respectively.

2015年10月30日 · In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species.

2022年6月7日 · We developed a Fusarium -specific high-throughput translation elongation factor 1α (EF-1α) amplicon-sequencing method with subspecies resolution. Newly designed primers enabled reads to be joined for improved quality metrics after Illumina MiSeq sequencing.